Synonyms: NCNP-01 | NS-065 | Viltepso®
viltolarsen is an approved drug (FDA (2020))
Compound class:
Synthetic organic
Comment: Viltolarsen is an antisense phosphorodiamidate morpholino oligomer (PMO) class nucleotide drug. Its abbreviated chemical/nucleotide structure is all-P-ambo-[2',3'-azanediyl-P,2',3'-trideoxy-P-(dimethylamino)-2',3'-seco](2'-N→5')(CCTCCGGTTCTGAAGGTGTTC). Viltolarsen restores the reading frame of certain dystrophin gene mutations and promotes synthesis of a shorter but functional dystrophin protein.
|
|
Download 2D Structure ![]() |
|
Canonical SMILES | Download |
Isomeric SMILES | Download |
Molecular structure representations generated using Open Babel