GtoPdb is requesting financial support from commercial users. Please see our sustainability page for more information.

plozasiran   Click here for help

GtoPdb Ligand ID: 13642

Synonyms: ARO-APOC3 | Redemplo®
Approved drug
plozasiran is an approved drug
Compound class: Nucleic acid
Comment: Plozasiran (ARO-APOC3) is a small interfering RNA (siRNA) class ligand. The molecule contains modified nucleotides to improve stability, and it is congugated with N-acetylgalactosamine (GalNAc; at the R1 position), which binds to asialoglycoprotein receptors expressed on hepatocyte membranes to promote delivery of the drug to the liver [4]. Once bound, the siRNA is internalised in lysosomes and is subsequently released into the cytosol. Plozasiran blocks synthesis of apolipoprotein C-III (APOC3), as a mechanism to reduce dyslipidemia that is linked to cardiovascular disease risk [1-2,6].
We have been unable to locate a full chemical SMILES for the ligand, or its HELM notation.
Nucleic Acid Sequence Click here for help
(3'-5')R1-ACGGGACAGUAUUCUCAGUIA
(5'-3')UGCCCUGUCAUAAGAGUCACU